Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5229214
End position: 5229258
Length: 45

DNA sequence
>NC_010322, from 5229214 to 5229258 (45 bp); Pseudomonas putida GB-1 CCAGTGCTGATCGGCCCCGGGGTGATCGGCGAGGTGCTGATCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5228734-5229537	Sequence	PputGB1_4680 - hypothetical protein (Protein is coded in complementary strand; from 5229537 to 5228734)