Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 1188073
End position: 1188117
Length: 45

DNA sequence
>NC_010322, from 1188073 to 1188117 (45 bp); Pseudomonas putida GB-1 CGGTTCGGTGACTGGCGGCTCGGTCACCGGTGGCTCGGTGACGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1186229-1188304	Sequence	PputGB1_1040 - hypothetical protein (Protein is coded in complementary strand; from 1188304 to 1186229)