Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5728000
End position: 5728035
Length: 36

DNA sequence
>NC_010322, from 5728000 to 5728035 (36 bp); Pseudomonas putida GB-1 AGGTCTTCGTTGTGGTCTTCCTTGAGGTCTTCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5727769-5728542	Sequence	PputGB1_5120 - cobyrinic acid ac-diamide synthase (Protein is coded in complementary strand; from 5728542 to 5727769)