Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5382203
End position: 5382238
Length: 36

DNA sequence
>NC_010322, from 5382203 to 5382238 (36 bp); Pseudomonas putida GB-1 CGGAGGCAATGGAGGCAATGGAGGCAATGGAGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5381364-5382308	Sequence	PputGB1_4814 - hypothetical protein (Protein is coded in complementary strand; from 5382308 to 5381364)