Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 2007427
End position: 2007462
Length: 36

DNA sequence
>NC_010322, from 2007427 to 2007462 (36 bp); Pseudomonas putida GB-1 AAGCGCAGTCGCAGTCGCAGTCGCAGTCGCAGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2006974-2007513	Sequence	PputGB1_1789 - ProQ activator of osmoprotectant transporter ProP