Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 500463
End position: 500497
Length: 35

DNA sequence
>NC_010322, from 500463 to 500497 (35 bp); Pseudomonas putida GB-1 GCAGCTTGAAGCTTGCGGCTTGTAGCTTGCCGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 500498-502420	Sequence	PputGB1_0428 - putative serine protein kinase PrkA (Protein is coded in complementary strand; from 502420 to 500498)