Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 1571235
End position: 1571269
Length: 35

DNA sequence
>NC_010322, from 1571235 to 1571269 (35 bp); Pseudomonas putida GB-1 AGGTGCCAGGTGCCAGGTGCCAGGTGCCAGGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1569297-1571237	Sequence	PputGB1_1397 - methyl-accepting chemotaxis sensory transducer