Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 3533950
End position: 3533979
Length: 30

DNA sequence
>NC_010322, from 3533950 to 3533979 (30 bp); Pseudomonas putida GB-1 TGCTGCTGCTGATCCTGCTGGTGCAGCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3533362-3534027	Sequence	PputGB1_3158 - binding-protein-dependent transport system inner membrane protein