Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5345468
End position: 5345494
Length: 27

DNA sequence
>NC_010322, from 5345468 to 5345494 (27 bp); Pseudomonas putida GB-1 TTCGGCTTCTTGGGCTTCTTCGGTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5345339-5346670	Sequence	PputGB1_4779 - DEAD/DEAH box helicase (Protein is coded in complementary strand; from 5346670 to 5345339)