Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5021560
End position: 5021586
Length: 27

DNA sequence
>NC_010322, from 5021560 to 5021586 (27 bp); Pseudomonas putida GB-1 CATGCCGCCCATGCCACCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5021555-5023198	Sequence	PputGB1_4488 groEL chaperonin GroEL (Protein is coded in complementary strand; from 5023198 to 5021555)