Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 2514013
End position: 2514039
Length: 27

DNA sequence
>NC_010322, from 2514013 to 2514039 (27 bp); Pseudomonas putida GB-1 GCACCAGCACCACCAGCAGCACCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2513691-2515103	Sequence	PputGB1_2252 - cytosine/purines uracil thiamine allantoin permease (Protein is coded in complementary strand; from 2515103 to 2513691)