Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 876648
End position: 876671
Length: 24

DNA sequence
>NC_010322, from 876648 to 876671 (24 bp); Pseudomonas putida GB-1 GCTGCCGCCGCCGATGCCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 876097-876957	Sequence	PputGB1_0767 ipk 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase (Protein is coded in complementary strand; from 876957 to 876097)