Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5833473
End position: 5833496
Length: 24

DNA sequence
>NC_010322, from 5833473 to 5833496 (24 bp); Pseudomonas putida GB-1 GCCTCGGCCTGGGCCTGGGCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5833065-5833838	Sequence	PputGB1_5219 - ABC transporter-like protein (Protein is coded in complementary strand; from 5833838 to 5833065)