Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5710921
End position: 5710944
Length: 24

DNA sequence
>NC_010322, from 5710921 to 5710944 (24 bp); Pseudomonas putida GB-1 TCCTTGGCCTTGACCTTGTCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5709130-5713809	Sequence	PputGB1_5111 - hypothetical protein (Protein is coded in complementary strand; from 5713809 to 5709130)