Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5632783
End position: 5632806
Length: 24

DNA sequence
>NC_010322, from 5632783 to 5632806 (24 bp); Pseudomonas putida GB-1 ACAGGATCAGGATCAGGAACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5630820-5632880	Sequence	PputGB1_5039 - methyl-accepting chemotaxis sensory transducer (Protein is coded in complementary strand; from 5632880 to 5630820)