Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5517793
End position: 5517816
Length: 24

DNA sequence
>NC_010322, from 5517793 to 5517816 (24 bp); Pseudomonas putida GB-1 CACCACCACCGCCACCGCCACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5516694-5517875	Sequence	PputGB1_4944 - HflK protein (Protein is coded in complementary strand; from 5517875 to 5516694)