Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 5093107
End position: 5093130
Length: 24

DNA sequence
>NC_010322, from 5093107 to 5093130 (24 bp); Pseudomonas putida GB-1 TGTTGATGATGATGTTGTCGTTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5092083-5093477	Sequence	PputGB1_4558 - PhoH family protein (Protein is coded in complementary strand; from 5093477 to 5092083)