Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 500056
End position: 500079
Length: 24

DNA sequence
>NC_010322, from 500056 to 500079 (24 bp); Pseudomonas putida GB-1 ACCGCCGCCGCCACCTCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 499082-500356	Sequence	PputGB1_0427 - hypothetical protein (Protein is coded in complementary strand; from 500356 to 499082)