Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 4596337
End position: 4596360
Length: 24

DNA sequence
>NC_010322, from 4596337 to 4596360 (24 bp); Pseudomonas putida GB-1 CCAGCGCCAGTGCCAGAGTCAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4596270-4597661	Sequence	PputGB1_4114 - GABA permease (Protein is coded in complementary strand; from 4597661 to 4596270)