Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 4566901
End position: 4566924
Length: 24

DNA sequence
>NC_010322, from 4566901 to 4566924 (24 bp); Pseudomonas putida GB-1 GCCAGCGCCTGCACCAGCGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4561858-4568325	Sequence	PputGB1_4086 - amino acid adenylation domain-containing protein (Protein is coded in complementary strand; from 4568325 to 4561858)