Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 4424922
End position: 4424945
Length: 24

DNA sequence
>NC_010322, from 4424922 to 4424945 (24 bp); Pseudomonas putida GB-1 GGCCAGCGCCAGGGCCTGGTCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4424896-4427589	Sequence	PputGB1_3979 alaS alanyl-tRNA synthetase (Protein is coded in complementary strand; from 4427589 to 4424896)