Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 4372287
End position: 4372310
Length: 24

DNA sequence
>NC_010322, from 4372287 to 4372310 (24 bp); Pseudomonas putida GB-1 CTCAGGCTCCGGCTCAGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4371634-4372416	Sequence	PputGB1_3928 fliH flagellar assembly protein H (Protein is coded in complementary strand; from 4372416 to 4371634)