Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 358753
End position: 358776
Length: 24

DNA sequence
>NC_010322, from 358753 to 358776 (24 bp); Pseudomonas putida GB-1 CGCTGGCGCTGTCGCCGGCACTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 358428-358871	Sequence	PputGB1_0308 - hypothetical protein (Protein is coded in complementary strand; from 358871 to 358428)