Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 3559736
End position: 3559759
Length: 24

DNA sequence
>NC_010322, from 3559736 to 3559759 (24 bp); Pseudomonas putida GB-1 CCTGCTCCAGCTCCTGCCCCTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3559012-3560637	Sequence	PputGB1_3184 - methyl-accepting chemotaxis sensory transducer (Protein is coded in complementary strand; from 3560637 to 3559012)