Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 3296470
End position: 3296493
Length: 24

DNA sequence
>NC_010322, from 3296470 to 3296493 (24 bp); Pseudomonas putida GB-1 GGCAAAGGCATAGGCAATGGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3295343-3296653	Sequence	PputGB1_2945 - major facilitator superfamily transporter (Protein is coded in complementary strand; from 3296653 to 3295343)