Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 3044731
End position: 3044754
Length: 24

DNA sequence
>NC_010322, from 3044731 to 3044754 (24 bp); Pseudomonas putida GB-1 CAGCACCAACACCGGCACCAGGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3043613-3044800	Sequence	PputGB1_2715 - glycosyl transferase family protein (Protein is coded in complementary strand; from 3044800 to 3043613)