Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 2958274
End position: 2958297
Length: 24

DNA sequence
>NC_010322, from 2958274 to 2958297 (24 bp); Pseudomonas putida GB-1 CCTGGCCCTTGCCATGGCGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2957913-2958500	Sequence	PputGB1_2641 - nucleoside phosphorylase-like protein (Protein is coded in complementary strand; from 2958500 to 2957913)