Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 2555808
End position: 2555831
Length: 24

DNA sequence
>NC_010322, from 2555808 to 2555831 (24 bp); Pseudomonas putida GB-1 GGCCTGCGCCTGCGCCTGGGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2554585-2555946	Sequence	PputGB1_2294 - gluconate 2-dehydrogenase (Protein is coded in complementary strand; from 2555946 to 2554585)