Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 2522982
End position: 2523005
Length: 24

DNA sequence
>NC_010322, from 2522982 to 2523005 (24 bp); Pseudomonas putida GB-1 CCCTTGGCCTTGTCCTTGCCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2522778-2523263	Sequence	PputGB1_2261 - flavin reductase domain-containing protein (Protein is coded in complementary strand; from 2523263 to 2522778)