Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 2365047
End position: 2365070
Length: 24

DNA sequence
>NC_010322, from 2365047 to 2365070 (24 bp); Pseudomonas putida GB-1 GGCCAGGGCGAGTGCCAGGGTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2364223-2365086	Sequence	PputGB1_2112 - hypothetical protein (Protein is coded in complementary strand; from 2365086 to 2364223)