Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 1877441
End position: 1877464
Length: 24

DNA sequence
>NC_010322, from 1877441 to 1877464 (24 bp); Pseudomonas putida GB-1 TCCTGGTGCTGGTGCTGGCCCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1877192-1878994	Sequence	PputGB1_1659 - lipid ABC transporter ATPase/inner membrane protein