Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 1750288
End position: 1750311
Length: 24

DNA sequence
>NC_010322, from 1750288 to 1750311 (24 bp); Pseudomonas putida GB-1 GCCAGGCCCAGGGCCAGGGCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1750057-1753701	Sequence	PputGB1_1556 - SMC domain-containing protein (Protein is coded in complementary strand; from 1753701 to 1750057)