Sequence retrieval

Genome: Pseudomonas putida GB-1
Start position: 1055709
End position: 1055732
Length: 24

DNA sequence
>NC_010322, from 1055709 to 1055732 (24 bp); Pseudomonas putida GB-1 CAGGTCCAGCTCCGGGTCCAGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1055434-1056258	Sequence	PputGB1_0920 - AraC family transcriptional regulator (Protein is coded in complementary strand; from 1056258 to 1055434)