Sequence retrieval

Genome: Bordetella petrii
Start position: 911783
End position: 911806
Length: 24

DNA sequence
>NC_010170, from 911783 to 911806 (24 bp); Bordetella petrii GGCGGCGGCGGAGTCGGCGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 911343-912044	Sequence	Bpet0824 - DnaA regulatory inactivator Hda (Protein is coded in complementary strand; from 912044 to 911343)