Sequence retrieval

Genome: Bordetella petrii
Start position: 733679
End position: 733723
Length: 45

DNA sequence
>NC_010170, from 733679 to 733723 (45 bp); Bordetella petrii TTTTTCAGCCGCGGCTTTTTCGGCAGCGGCCTTCTCAGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 733209-734396	Sequence	Bpet0659 tolA colicin exporter (Protein is coded in complementary strand; from 734396 to 733209)