Sequence retrieval

Genome: Bordetella petrii
Start position: 721753
End position: 721776
Length: 24

DNA sequence
>NC_010170, from 721753 to 721776 (24 bp); Bordetella petrii GGGGGCGGCGGCGGGGGCGGGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 720890-721801	Sequence	Bpet0646 - DMT superfamily permease (Protein is coded in complementary strand; from 721801 to 720890)