Sequence retrieval

Genome: Bordetella petrii
Start position: 5144520
End position: 5144549
Length: 30

DNA sequence
>NC_010170, from 5144520 to 5144549 (30 bp); Bordetella petrii GTACCCCTTAGTTCGCCTTAGTACCCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 5144538-5145476	Sequence	Bpet4875 ycdW2 2-hydroxyacid dehydrogenase (Protein is coded in complementary strand; from 5145476 to 5144538)