Sequence retrieval

Genome: Bordetella petrii
Start position: 5058105
End position: 5058128
Length: 24

DNA sequence
>NC_010170, from 5058105 to 5058128 (24 bp); Bordetella petrii ACCTGGACCTCGGCCTGGACCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5057670-5058692	Sequence	Bpet4788 - hypothetical protein (Protein is coded in complementary strand; from 5058692 to 5057670)