Sequence retrieval

Genome: Bordetella petrii
Start position: 5056650
End position: 5056673
Length: 24

DNA sequence
>NC_010170, from 5056650 to 5056673 (24 bp); Bordetella petrii TCGTGGTCATGGTCGTGATCATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5055465-5057519	Sequence	Bpet4787 - TonB-dependent outer membrane receptor (Protein is coded in complementary strand; from 5057519 to 5055465)