Sequence retrieval

Genome: Bordetella petrii
Start position: 5039915
End position: 5039965
Length: 51

DNA sequence
>NC_010170, from 5039915 to 5039965 (51 bp); Bordetella petrii CGCCGTGGATACCCTTGCGCCGTGGATACCCTTGCGCCGCGGATACCCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5039913-5040173	Sequence	Bpet4770 - hypothetical protein (Protein is coded in complementary strand; from 5040173 to 5039913)