Sequence retrieval

Genome: Bordetella petrii
Start position: 5004619
End position: 5004654
Length: 36

DNA sequence
>NC_010170, from 5004619 to 5004654 (36 bp); Bordetella petrii CAGCGCGAACACCACCACGAACACCAGCACGAACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5004137-5005201	Sequence	Bpet4740 - branched-chain amino acid transport system permease (Protein is coded in complementary strand; from 5005201 to 5004137)