Sequence retrieval

Genome: Bordetella petrii
Start position: 4721418
End position: 4721441
Length: 24

DNA sequence
>NC_010170, from 4721418 to 4721441 (24 bp); Bordetella petrii GGCGCTGGCGCTGGCGCTGGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4720954-4723008	Sequence	Bpet4472 bvgS2 virulence sensor protein (Protein is coded in complementary strand; from 4723008 to 4720954)