Sequence retrieval

Genome: Bordetella petrii
Start position: 4441405
End position: 4441431
Length: 27

DNA sequence
>NC_010170, from 4441405 to 4441431 (27 bp); Bordetella petrii TCGCCGATTTCGCCGATTTCGCCGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4441393-4442298	Sequence	Bpet4196 - fumarylacetoacetate hydrolase (Protein is coded in complementary strand; from 4442298 to 4441393)