Sequence retrieval

Genome: Bordetella petrii
Start position: 4440816
End position: 4440839
Length: 24

DNA sequence
>NC_010170, from 4440816 to 4440839 (24 bp); Bordetella petrii CGGCCTGGGCCTCGGCCAGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4440617-4441396	Sequence	Bpet4195 - 2-hydroxymuconic semialdehyde hydrolase (Protein is coded in complementary strand; from 4441396 to 4440617)