Sequence retrieval

Genome: Bordetella petrii
Start position: 4396550
End position: 4396579
Length: 30

DNA sequence
>NC_010170, from 4396550 to 4396579 (30 bp); Bordetella petrii CGCCGCCGTCGCCTCCGCCGCCCCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4394008-4396911	Sequence	Bpet4156 - autotransporter (Protein is coded in complementary strand; from 4396911 to 4394008)