Sequence retrieval

Genome: Bordetella petrii
Start position: 4172500
End position: 4172535
Length: 36

DNA sequence
>NC_010170, from 4172500 to 4172535 (36 bp); Bordetella petrii TCGTCCTCTTCGTCTTCGTCTTCGTCGTCTTCTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4172467-4172994	Sequence	Bpet3957 ribH 6,7-dimethyl-8-ribityllumazine synthase (Protein is coded in complementary strand; from 4172994 to 4172467)