Sequence retrieval

Genome: Bordetella petrii
Start position: 3877781
End position: 3877804
Length: 24

DNA sequence
>NC_010170, from 3877781 to 3877804 (24 bp); Bordetella petrii GTCCAGGTCCAGCTCCAGGCCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3877650-3878153	Sequence	Bpet3666 - AhpC/TSA family protein (Protein is coded in complementary strand; from 3878153 to 3877650)