Sequence retrieval

Genome: Bordetella petrii
Start position: 3751350
End position: 3751373
Length: 24

DNA sequence
>NC_010170, from 3751350 to 3751373 (24 bp); Bordetella petrii CCGCGCCGGCGCCGGCGCCCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3750848-3751888	Sequence	Bpet3549 - ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 3751888 to 3750848)