Sequence retrieval

Genome: Bordetella petrii
Start position: 3668503
End position: 3668547
Length: 45

DNA sequence
>NC_010170, from 3668503 to 3668547 (45 bp); Bordetella petrii CCCGCGCCGTCGAGCCCCGCGCCGTCGAGCCCCGCGCCGTCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3668377-3668601	Sequence	Bpet3472 - hypothetical protein (Protein is coded in complementary strand; from 3668601 to 3668377)