Sequence retrieval

Genome: Bordetella petrii
Start position: 3573762
End position: 3573788
Length: 27

DNA sequence
>NC_010170, from 3573762 to 3573788 (27 bp); Bordetella petrii TGGGGCGGTTCGGGCGGTTCGGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3573213-3573848	Sequence	Bpet3392 - nuclease (Protein is coded in complementary strand; from 3573848 to 3573213)